This tutorial describes an easy method to prepare, in less than 24 hours, point mutations, large deletions and small insertions in any plasmid using a single mutagenic primer and Pfu Turbo polymerase. The primer contains the desired mutation surrounded by upstream and downstream flanking sequences that match the template plasmid sequence. The polymerase (in a thermal cycler) extends the primer around the full length of the plasmid and the product is digested with DpnI to remove the template DNA, leaving only the mutated product, which is transformed into competent bacteria.
In this tutorial, we will mutate lysine 63 of ubiquitin to arginine in the “virtual” expression vector pCDNA-human-ubiquitin. Specifically, the lysine codon ‘AAG’ (at position 1109 of the vector) will be mutated to the arginine codon ‘AGG’. Now, we design upstream and downstream flanking sequences that are sufficiently long to give a melting temperature (Tm), individually, of approximately 60 °C. I use the Oligo Analyzer program from IDT to calculate the Tm of each arm. In the image below, the mutation site is highlighted in black, the 5′ arm is blue and the 3′ arm is red.
5′ arm: CCGTACTCTTTCTGACTACAACATCCAGA
mutation site: G
3′ arm: GGAGTCGACCCTGCACCTG
full primer (K63R): CCGTACTCTTTCTGACTACAACATCCAGAGGGAGTCGACCCTGCACCTG
Since these primers are usually quite long (50-60 nucleotides), you are better off to have the company that synthesize the oligos purify them to remove any truncated forms (eg. by HPLC or other chromatographic method).
Now for the easy part! Prepare the following reaction mix in a PCR tube:
- 1 ul 50 g/ul pCDNA-human-ubiquitin-WT DNA
- 3 ul 2 uM K63R primer
- 2.5 ul 10x Pfu buffer
- 0.75 ul 10 mM dNTPs
- 17.2 ul dH2O
- 0.5 ul Pfu enzyme (Turbo or Ultra)
Also include one reaction without any primer as a control.
Place tubes in a thermal cycler and run with the following cycling conditions:
- 96 C, 3 min
- (96 C, 1 min, 60 C, 1 min, 68 C, 15 min) x 18
- 68 C, 20 min
Then, remove the tubes from the thermal cycler and add 1 ul of DpnI enzyme. DpnI is active in the Pfu reaction buffer. Mix well and incubate for 2 hours at 37 C. The parental (methylated) DNA should now be digested, leaving you with mutated (non-methylated) DNA.
Finally, transform 10 ul of the DpnI treated reaction mix into 100 ul of your favorite competent bacteria (eg. DH5α) by heat shock. Plate the transformed cells on LB-Agar plates containing the appropriate antibiotic (ampicillin for pCDNA3.1) and grow overnight. If you end up with more colonies from your reaction mix with primers than from your control reaction, the mutagenesis has likely worked! Purified plasmid DNA from these colonies can be screened by DNA sequencing or restriction digest.

